User:Anylyn Hax

str_replace() // No need to cry any more here you got it ... string str_replace (string search, string replace, string str) { integer index; integer lenght_of_search = llStringLength(search); integer lenght_of_replace= llStringLength(replace); do { index = llSubStringIndex(str, search); str = llDeleteSubString(str, index, index + lenght_of_search -1); str = llInsertString(str, index, replace); } while(~llSubStringIndex(str, search)); return str; } default { state_entry() { string some_long_string = "aaacccaaacccaaagggaaaggg"; llOwnerSay(str_replace( "aaa", "bbb", some_long_string )); } } Anylyn Hax 04:48, 9 August 2007 (PDT) StartAnimation-Example For those avatars who need to use another walking animation, other then the one supplied by LL here is a small goodie. // I like to use Antoinette Lioncourt's sexywalk // UUID:51e4d6c1-0bf0-f7b9-2cc7-8d7b46baf35b // place this script in one of your shoes together with the sexywalk default { state_entry() { llRequestPermissions(llGetOwner(),PERMISSION_TRIGGER_ANIMATION ); } run_time_permissions(integer perm) { if(PERMISSION_TRIGGER_ANIMATION & perm) { llSetTimerEvent(.1); } } timer() { vector vel = llGetVel(); if( llFabs(vel.x) > 0.1)llStartAnimation("sexywalk"); if( llFabs(vel.x)<= 0.1)llStopAnimation("sexywalk"); } } Anylyn Hax 21:43, 1 June 2007 (PDT) SetPrimitiveParams-Example // This ugly hack gives out a peace of Human Readable Code, as demanded // by llSetPrimitiveParams. The result of this program comes via llOwnerSay // on the chat channel. Its a good idea to cut objectname and date out ;) // created by Anylyn Hax in the hot summer of 2007. // // This program is free software: you can redistribute it and/or modify // it under the terms of the GNU General Public License as published by // the Free Software Foundation, either version 3 of the License, or // (at your option) any later version. // // This program is distributed in the hope that it will be useful, // but WITHOUT ANY WARRANTY; without even the implied warranty of // MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the // GNU General Public License for more details. // // You should have received a copy of the GNU General Public License // along with this program. If not, see <http://www.gnu.org/licenses/>. default { state_entry() { integer i = 0; integer ce_side = llGetNumberOfSides(); list booleans = ([ "FALSE", // 0 "TRUE" // 1 ]); list texgens = ([ "PRIM_TEXGEN_DEFAULT", // 0 "PRIM_TEXGEN_PLANAR" // 1 ]); list holeshape = ([ "PRIM_HOLE_DEFAULT", // 0 default (matches the prim type: square for box, circle for cylinder, etc.) "","","","","","","","","","","","","","","", "PRIM_HOLE_CIRCLE", // 16 circle "","","","","","","","","","","","","","","", "PRIM_HOLE_SQUARE", // 32 square "","","","","","","","","","","","","","","", "PRIM_HOLE_TRIANGLE" // 48 triangle ]); list sculpttype = ([ "PRIM_SCULPT_TYPE_SPHERE", // 1 sphere (Converge top & bottom, stitch left side to right) "PRIM_SCULPT_TYPE_TORUS", // 2 torus (Stitch top to bottom, stitch left side to right) "PRIM_SCULPT_TYPE_PLANE", // 3 plane (No stitching or converging) "PRIM_SCULPT_TYPE_CYLINDER" // 4 cylinder (Stitch left side to right, leave top and bottom open) ]); list bumpmapping = ([ "PRIM_BUMP_NONE", // 0 none: no bump map "PRIM_BUMP_BRIGHT", // 1 brightness: generate bump map from highlights "PRIM_BUMP_DARK", // 2 darkness: generate bump map from lowlights "PRIM_BUMP_WOOD", // 3 woodgrain "PRIM_BUMP_BARK", // 4 bark "PRIM_BUMP_BRICKS", // 5 bricks "PRIM_BUMP_CHECKER", // 6 checker "PRIM_BUMP_CONCRETE", // 7 concrete "PRIM_BUMP_TILE", // 8 crustytile "PRIM_BUMP_STONE", // 9 cutstone: blocks "PRIM_BUMP_DISKS", // 10 discs: packed circles "PRIM_BUMP_GRAVEL", // 11 gravel "PRIM_BUMP_SIDING", // 13 siding "PRIM_BUMP_LARGETILE", // 14 stonetile "PRIM_BUMP_STUCCO", // 15 stucco "PRIM_BUMP_SUCTION", // 16 suction: rings "PRIM_BUMP_WEAVE" // 17 weave ]); list shinys = ([ "PRIM_SHINY_NONE", // 0 none "PRIM_SHINY_LOW", // 1 low "PRIM_SHINY_MEDIUM", // 2 medium "PRIM_SHINY_HIGH" // 3 high ]); list materials =([ "PRIM_MATERIAL_STONE", // 0 stone "PRIM_MATERIAL_METAL", // 1 metal "PRIM_MATERIAL_GLASS", // 2 glass "PRIM_MATERIAL_WOOD", // 3 wood "PRIM_MATERIAL_FLESH", // 4 flesh "PRIM_MATERIAL_PLASTIC", // 5 plastic "PRIM_MATERIAL_RUBBER", // 6 rubber "PRIM_MATERIAL_LIGHT" // 7 light ]); llOwnerSay("llSetPrimitiveParams(["); list ce_prim_flexible = llGetPrimitiveParams([PRIM_FLEXIBLE]); // 21 llOwnerSay("PRIM_FLEXIBLE"+ ", "+(string)llList2String(booleans ,llList2Integer(ce_prim_flexible,0))+ // true / false ", "+(string)llList2Float(ce_prim_flexible,1)+ // softness ", "+(string)llList2Float(ce_prim_flexible,2)+ // gravity ", "+(string)llList2Float(ce_prim_flexible,3)+ // friction ", "+(string)llList2Float(ce_prim_flexible,4)+ // wind ", "+(string)llList2Float(ce_prim_flexible,5)+ // tension ", "+(string)llList2Vector(ce_prim_flexible,6)+", "); // force ce_prim_flexible =[]; list ce_prim_material = llGetPrimitiveParams([PRIM_MATERIAL]); // 2 llOwnerSay("PRIM_MATERIAL, "+(string)llList2String(materials ,llList2Integer(ce_prim_material,0))+", "); ce_prim_material = []; list ce_prim_phantom = llGetPrimitiveParams([PRIM_PHANTOM]); // 5 llOwnerSay("PRIM_PHANTOM, "+(string)llList2String(booleans ,llList2Integer(ce_prim_phantom ,0))+", "); ce_prim_phantom = []; list ce_prim_physiks = llGetPrimitiveParams([PRIM_PHYSICS]); // 3 llOwnerSay("PRIM_PHYSICS, "+(string)llList2String(booleans ,llList2Integer(ce_prim_physiks ,0))+", "); ce_prim_physiks = []; list ce_prim_point_light = llGetPrimitiveParams([PRIM_POINT_LIGHT]); // 23 llOwnerSay("PRIM_POINT_LIGHT"+ ", "+(string)llList2String(booleans ,llList2Integer(ce_prim_point_light,0))+ // true / false ", "+(string)llList2Vector(ce_prim_point_light,1)+ // color ", "+(string)llList2Float(ce_prim_point_light,2)+ // intensity ", "+(string)llList2Float(ce_prim_point_light,3)+ // radius ", "+(string)llList2Float(ce_prim_point_light,4)+", "); // falloff ce_prim_point_light = []; list ce_prim_position = llGetPrimitiveParams([PRIM_POSITION]); // 6 llOwnerSay("PRIM_POSITION, "+(string)llList2Vector(ce_prim_position ,0)+", "); ce_prim_position = []; list ce_prim_rotation = llGetPrimitiveParams([PRIM_ROTATION]); // 8 llOwnerSay("PRIM_ROTATION, "+(string)llList2Rot(ce_prim_rotation ,0)+", "); ce_prim_rotation = []; list ce_prim_size = llGetPrimitiveParams([PRIM_SIZE]); // 7 llOwnerSay("PRIM_SIZE, "+(string)llList2Vector(ce_prim_size ,0)+", "); ce_prim_size = []; list ce_prim_temp_on_rez = llGetPrimitiveParams([PRIM_TEMP_ON_REZ]); // 4 llOwnerSay("PRIM_TEMP_ON_REZ, "+(string)llList2String(booleans ,llList2Integer(ce_prim_temp_on_rez ,0))+", "); ce_prim_temp_on_rez = []; list ce_prim_type = llGetPrimitiveParams([PRIM_TYPE]); // 9 if(llList2Integer(ce_prim_type,0)==0){llOwnerSay("PRIM_TYPE, PRIM_TYPE_BOX"+", "+(string)llList2String(holeshape ,llList2Integer(ce_prim_type,1))+", "+(string)llList2Vector(ce_prim_type,2)+", "+(string)llList2Float(ce_prim_type,3)+", "+(string)llList2Vector(ce_prim_type,4)+", "+(string)llList2Vector(ce_prim_type,5)+", "+(string)llList2Vector(ce_prim_type,6)+", ");} if(llList2Integer(ce_prim_type,0)==1){llOwnerSay("PRIM_TYPE, PRIM_TYPE_CYLINDER"+", "+(string)llList2String(holeshape ,llList2Integer(ce_prim_type,1))+", "+(string)llList2Vector(ce_prim_type,2)+", "+(string)llList2Float(ce_prim_type,3)+", "+(string)llList2Vector(ce_prim_type,4)+", "+(string)llList2Vector(ce_prim_type,5)+", "+(string)llList2Vector(ce_prim_type,6)+", ");} if(llList2Integer(ce_prim_type,0)==2){llOwnerSay("PRIM_TYPE, PRIM_TYPE_PRISM"+", "+(string)llList2String(holeshape ,llList2Integer(ce_prim_type,1))+", "+(string)llList2Vector(ce_prim_type,2)+", "+(string)llList2Float(ce_prim_type,3)+", "+(string)llList2Vector(ce_prim_type,4)+", "+(string)llList2Vector(ce_prim_type,5)+", "+(string)llList2Vector(ce_prim_type,6)+", ");} if(llList2Integer(ce_prim_type,0)==3){llOwnerSay("PRIM_TYPE, PRIM_TYPE_SPHERE"+", "+(string)llList2Integer(ce_prim_type,1)+", "+(string)llList2Vector(ce_prim_type,2)+", "+(string)llList2Float(ce_prim_type,3)+", "+(string)llList2Vector(ce_prim_type,4)+", "+(string)llList2Vector(ce_prim_type,5)+", ");} if(llList2Integer(ce_prim_type,0)==4){llOwnerSay("PRIM_TYPE, PRIM_TYPE_TORUS"+", "+(string)llList2String(holeshape ,llList2Integer(ce_prim_type,1))+", "+(string)llList2Vector(ce_prim_type,2)+", "+(string)llList2Float(ce_prim_type,3)+", "+(string)llList2Vector(ce_prim_type,4)+", "+(string)llList2Vector(ce_prim_type,5)+", "+(string)llList2Vector(ce_prim_type,6)+", "+(string)llList2Vector(ce_prim_type,7)+", "+(string)llList2Vector(ce_prim_type,8)+", "+(string)llList2Float(ce_prim_type,9)+", "+(string)llList2Float(ce_prim_type,10)+", "+(string)llList2Float(ce_prim_type,11)+", ");} if(llList2Integer(ce_prim_type,0)==5){llOwnerSay("PRIM_TYPE, PRIM_TYPE_TUBE"+", "+(string)llList2String(holeshape ,llList2Integer(ce_prim_type,1))+", "+(string)llList2Vector(ce_prim_type,2)+", "+(string)llList2Float(ce_prim_type,3)+", "+(string)llList2Vector(ce_prim_type,4)+", "+(string)llList2Vector(ce_prim_type,5)+", "+(string)llList2Vector(ce_prim_type,6)+", "+(string)llList2Vector(ce_prim_type,7)+", "+(string)llList2Vector(ce_prim_type,8)+", "+(string)llList2Float(ce_prim_type,9)+", "+(string)llList2Float(ce_prim_type,10)+", "+(string)llList2Float(ce_prim_type,11)+", ");} if(llList2Integer(ce_prim_type,0)==6){llOwnerSay("PRIM_TYPE, PRIM_TYPE_RING"+", "+(string)llList2String(holeshape ,llList2Integer(ce_prim_type,1))+", "+(string)llList2Vector(ce_prim_type,2)+", "+(string)llList2Float(ce_prim_type,3)+", "+(string)llList2Vector(ce_prim_type,4)+", "+(string)llList2Vector(ce_prim_type,5)+", "+(string)llList2Vector(ce_prim_type,6)+", "+(string)llList2Vector(ce_prim_type,7)+", "+(string)llList2Vector(ce_prim_type,8)+", "+(string)llList2Float(ce_prim_type,9)+", "+(string)llList2Float(ce_prim_type,10)+", "+(string)llList2Float(ce_prim_type,11)+", ");} if(llList2Integer(ce_prim_type,0)==7){llOwnerSay("PRIM_TYPE, PRIM_TYPE_SCULPT"+", "+(string)llList2String(ce_prim_type,1)+", "+(string)llList2Integer(ce_prim_type,2)+", ");} ce_prim_type = []; i = 0; list ce_prim_fullbright; while(i <= ce_side) { ce_prim_fullbright = llGetPrimitiveParams([PRIM_FULLBRIGHT,i]); // 20 if (ce_prim_fullbright != []) { llOwnerSay("PRIM_FULLBRIGHT, "+(string)i+", "+(string)llList2String(booleans ,llList2Integer(ce_prim_fullbright,0))+", "); ce_prim_fullbright = []; } i++; } i = 0; list ce_prim_bump_shiny; while(i <= ce_side) { ce_prim_bump_shiny = llGetPrimitiveParams([PRIM_BUMP_SHINY,i]); // 19 if (ce_prim_bump_shiny != []) { llOwnerSay("PRIM_BUMP_SHINY, "+(string)i+", "+llList2String(shinys,llList2Integer(ce_prim_bump_shiny,0))+ // shiny ", "+llList2String(bumpmapping ,llList2Integer(ce_prim_bump_shiny,1))+", ");// bumpmaping ce_prim_bump_shiny = []; } i++; } i = 0; list ce_prim_color; while(i <= ce_side) { ce_prim_color = llGetPrimitiveParams([PRIM_COLOR,i]); // 18 if (ce_prim_color != []) { llOwnerSay("PRIM_COLOR, "+(string)i+", "+(string)llList2Vector(ce_prim_color,0)+", "+(string)llList2Float(ce_prim_color,1)+", "); ce_prim_color = []; } i++; } i = 0; list ce_prim_texgen; while(i <= ce_side) { ce_prim_texgen = llGetPrimitiveParams([PRIM_TEXGEN ,i]); // 22 if (ce_prim_texgen != []) { llOwnerSay("PRIM_TEXGEN, "+(string)i+", "+llList2String(texgens,llList2Integer(ce_prim_texgen,0))+", "); // type ce_prim_texgen = []; } i++; } i = 0; string koma = ""; list ce_prim_texture; while(i <= ce_side) { ce_prim_texture = llGetPrimitiveParams([PRIM_TEXTURE,i]); // 17 if(i < ce_side -1) { koma = ", "; } // we dont put everywhere a komata if (ce_prim_texture != []) { llOwnerSay("PRIM_TEXTURE, "+(string)i+ ", "+(string)llList2String(ce_prim_texture,0)+ // name ", "+(string)llList2Vector(ce_prim_texture,1)+ // repeats ", "+(string)llList2Vector(ce_prim_texture,2)+ // offsets ", "+(string)llList2Float(ce_prim_texture,3) + koma); // rotation ce_prim_texture = []; koma = ""; } i++; } llOwnerSay("]);"); llOwnerSay("//This Script used " + (string)((16384 - llGetFreeMemory())/1024) + " kBytes"); } } ... and outputs something like this: [23:00] Object: llSetPrimitiveParams([ [23:00] Object: PRIM_FLEXIBLE, TRUE, 2.000000, 0.300000, 2.000000, 0.000000, 1.000000, <0.01000, 0.00000, 0.01000>, [23:00] Object: PRIM_MATERIAL, PRIM_MATERIAL_WOOD, [23:00] Object: PRIM_PHANTOM, TRUE, [23:00] Object: PRIM_PHYSICS, FALSE, [23:00] Object: PRIM_POINT_LIGHT, TRUE, <1.00000, 1.00000, 1.00000>, 1.000000, 10.000000, 0.750000, [23:00] Object: PRIM_POSITION, <57.18748, 200.57619, 21.45186>, [23:00] Object: PRIM_ROTATION, <0.00000, 0.00000, 0.00000, 1.00000>, [23:00] Object: PRIM_SIZE, <0.76611, 0.76611, 0.76611>, [23:00] Object: PRIM_TEMP_ON_REZ, FALSE, [23:00] Object: PRIM_TYPE, PRIM_TYPE_BOX, PRIM_HOLE_CIRCLE, <0.00000, 1.00000, 0.00000>, 0.099900, <0.00000, 0.00000, 0.00000>, <1.00000, 1.00000, 0.00000>, <0.00000, 0.00000, 0.00000>, [23:00] Object: PRIM_FULLBRIGHT, 0, TRUE, [23:00] Object: PRIM_FULLBRIGHT, 1, TRUE, [23:00] Object: PRIM_FULLBRIGHT, 2, TRUE, [23:00] Object: PRIM_FULLBRIGHT, 3, TRUE, [23:00] Object: PRIM_FULLBRIGHT, 4, TRUE, [23:00] Object: PRIM_FULLBRIGHT, 5, TRUE, [23:00] Object: PRIM_FULLBRIGHT, 6, TRUE, [23:00] Object: PRIM_BUMP_SHINY, 0, PRIM_SHINY_MEDIUM, PRIM_BUMP_CHECKER, [23:00] Object: PRIM_BUMP_SHINY, 1, PRIM_SHINY_MEDIUM, PRIM_BUMP_CHECKER, [23:00] Object: PRIM_BUMP_SHINY, 2, PRIM_SHINY_MEDIUM, PRIM_BUMP_CHECKER, [23:00] Object: PRIM_BUMP_SHINY, 3, PRIM_SHINY_MEDIUM, PRIM_BUMP_CHECKER, [23:00] Object: PRIM_BUMP_SHINY, 4, PRIM_SHINY_MEDIUM, PRIM_BUMP_CHECKER, [23:00] Object: PRIM_BUMP_SHINY, 5, PRIM_SHINY_MEDIUM, PRIM_BUMP_CHECKER, [23:00] Object: PRIM_BUMP_SHINY, 6, PRIM_SHINY_MEDIUM, PRIM_BUMP_CHECKER, [23:00] Object: PRIM_COLOR, 0, <1.00000, 1.00000, 1.00000>, 1.000000, [23:00] Object: PRIM_COLOR, 1, <1.00000, 1.00000, 1.00000>, 1.000000, [23:00] Object: PRIM_COLOR, 2, <1.00000, 1.00000, 1.00000>, 1.000000, [23:00] Object: PRIM_COLOR, 3, <1.00000, 1.00000, 1.00000>, 1.000000, [23:00] Object: PRIM_COLOR, 4, <1.00000, 1.00000, 1.00000>, 1.000000, [23:00] Object: PRIM_COLOR, 5, <1.00000, 1.00000, 1.00000>, 1.000000, [23:00] Object: PRIM_COLOR, 6, <1.00000, 1.00000, 1.00000>, 1.000000, [23:00] Object: PRIM_TEXGEN, 0, PRIM_TEXGEN_PLANAR, [23:00] Object: PRIM_TEXGEN, 1, PRIM_TEXGEN_PLANAR, [23:00] Object: PRIM_TEXGEN, 2, PRIM_TEXGEN_PLANAR, [23:00] Object: PRIM_TEXGEN, 3, PRIM_TEXGEN_PLANAR, [23:00] Object: PRIM_TEXGEN, 4, PRIM_TEXGEN_PLANAR, [23:00] Object: PRIM_TEXGEN, 5, PRIM_TEXGEN_PLANAR, [23:00] Object: PRIM_TEXGEN, 6, PRIM_TEXGEN_PLANAR, [23:00] Object: PRIM_TEXTURE, 0, 89556747-24cb-43ed-920b-47caed15465f, <1.00000, 1.00000, 0.00000>, <0.00000, 0.00000, 0.00000>, 0.000000, [23:00] Object: PRIM_TEXTURE, 1, 89556747-24cb-43ed-920b-47caed15465f, <1.00000, 1.00000, 0.00000>, <0.00000, 0.00000, 0.00000>, 0.000000, [23:00] Object: PRIM_TEXTURE, 2, 89556747-24cb-43ed-920b-47caed15465f, <1.00000, 1.00000, 0.00000>, <0.00000, 0.00000, 0.00000>, 0.000000, [23:00] Object: PRIM_TEXTURE, 3, 89556747-24cb-43ed-920b-47caed15465f, <1.00000, 1.00000, 0.00000>, <0.00000, 0.00000, 0.00000>, 0.000000, [23:00] Object: PRIM_TEXTURE, 4, 89556747-24cb-43ed-920b-47caed15465f, <1.00000, 1.00000, 0.00000>, <0.00000, 0.00000, 0.00000>, 0.000000, [23:00] Object: PRIM_TEXTURE, 5, 89556747-24cb-43ed-920b-47caed15465f, <1.00000, 1.00000, 0.00000>, <0.00000, 0.00000, 0.00000>, 0.000000, [23:00] Object: PRIM_TEXTURE, 6, 89556747-24cb-43ed-920b-47caed15465f, <1.00000, 1.00000, 0.00000>, <0.00000, 0.00000, 0.00000>, 0.000000 [23:00] Object: ]); Anylyn Hax 15:58, 8 August 2007 (PDT) View the issues Anylyn Hax has filed at jira.secondlife.com